Transcript: Human XM_017006128.1

PREDICTED: Homo sapiens growth associated protein 43 (GAP43), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GAP43 (2596)
Length:
3351
CDS:
1924..2748

Additional Resources:

NCBI RefSeq record:
XM_017006128.1
NBCI Gene record:
GAP43 (2596)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000447221 GCTCATAAGGCCGCAACCAAA pLKO_005 2122 CDS 100% 4.950 6.930 N GAP43 n/a
2 TRCN0000047323 CGTGGACACATAACAAGGAAA pLKO.1 2158 CDS 100% 4.950 3.960 N GAP43 n/a
3 TRCN0000047327 CAAGATGGTATCAAACCAGAA pLKO.1 2095 CDS 100% 4.050 3.240 N GAP43 n/a
4 TRCN0000421227 GTCAAACAGTGTGGCTTAAAC pLKO_005 2947 3UTR 100% 13.200 9.240 N GAP43 n/a
5 TRCN0000047326 CCACTAAAGCTTCCACTGATA pLKO.1 2459 CDS 100% 4.950 3.465 N GAP43 n/a
6 TRCN0000047325 TGTAGATGAAACCAAACCTAA pLKO.1 2664 CDS 100% 4.950 3.465 N GAP43 n/a
7 TRCN0000047324 GCTGAAGCTAATAAGAAGGAT pLKO.1 2221 CDS 100% 3.000 2.100 N GAP43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.