Transcript: Human XM_017006179.1

PREDICTED: Homo sapiens RNA binding motif single stranded interacting protein 3 (RBMS3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBMS3 (27303)
Length:
8614
CDS:
823..2085

Additional Resources:

NCBI RefSeq record:
XM_017006179.1
NBCI Gene record:
RBMS3 (27303)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153312 GCAGATGAATCACCTTTCGTT pLKO.1 1833 CDS 100% 3.000 4.200 N RBMS3 n/a
2 TRCN0000421927 ATGGACCATCCCATGTCAATG pLKO_005 1780 CDS 100% 10.800 8.640 N RBMS3 n/a
3 TRCN0000153403 GCTGCCATACAGAATGGATTT pLKO.1 1594 CDS 100% 10.800 7.560 N RBMS3 n/a
4 TRCN0000152525 GACATCTATCACGCCATTCAT pLKO.1 1659 CDS 100% 5.625 3.938 N RBMS3 n/a
5 TRCN0000152012 CACAAATCAGTGCAAAGGTTA pLKO.1 1110 CDS 100% 4.950 3.465 N RBMS3 n/a
6 TRCN0000151205 GACATGTCATTTCCACAAGAA pLKO.1 1310 CDS 100% 4.950 3.465 N RBMS3 n/a
7 TRCN0000157243 CATGGACCATCCCATGTCAAT pLKO.1 1779 CDS 100% 0.495 0.347 N RBMS3 n/a
8 TRCN0000414938 TGAGCCTTTGCTGTGCAAATT pLKO_005 1464 CDS 100% 13.200 7.920 N RBMS3 n/a
9 TRCN0000096890 GCTGTTTCTATTGAAGGTGTT pLKO.1 1936 CDS 100% 4.050 2.430 N Rbms3 n/a
10 TRCN0000151605 GCTGTTTCTATTGAAGGTGTT pLKO.1 1936 CDS 100% 4.050 2.430 N RBMS3 n/a
11 TRCN0000158276 CAGCAACAACAGCAGCAACAA pLKO.1 954 CDS 100% 4.950 2.475 Y RBMS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11862 pDONR223 100% 59.3% 58.9% None (many diffs) n/a
2 ccsbBroad304_11862 pLX_304 0% 59.3% 58.9% V5 (many diffs) n/a
3 TRCN0000469899 GCTCCCGTCAAATCGATTTGTAGC pLX_317 61.1% 59.3% 58.9% V5 (many diffs) n/a
Download CSV