Transcript: Human XM_017006535.1

PREDICTED: Homo sapiens ssu-2 homolog (SSUH2), transcript variant X28, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SSUH2 (51066)
Length:
6564
CDS:
5083..6426

Additional Resources:

NCBI RefSeq record:
XM_017006535.1
NBCI Gene record:
SSUH2 (51066)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006535.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142676 CTCTGGGACATCAAGGTTCAA pLKO.1 6097 CDS 100% 4.950 3.465 N SSUH2 n/a
2 TRCN0000143338 GAAGAAGCTGTTGCACTTCAT pLKO.1 6384 CDS 100% 4.950 3.465 N SSUH2 n/a
3 TRCN0000141894 GCACTTCATCCAGCTTGTCAT pLKO.1 6396 CDS 100% 4.950 3.465 N SSUH2 n/a
4 TRCN0000141252 CCTCAGCTTTGTGGACTCTAA pLKO.1 5904 CDS 100% 4.950 2.970 N SSUH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006535.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14133 pDONR223 100% 32.2% 32.1% None 1_792del;797C>N;1341_1342ins357 n/a
2 ccsbBroad304_14133 pLX_304 0% 32.2% 32.1% V5 1_792del;797C>N;1341_1342ins357 n/a
3 TRCN0000470481 GACTAAGTTATTCCCTTTCAAGCG pLX_317 41% 32.2% 32.1% V5 1_792del;797C>N;1341_1342ins357 n/a
Download CSV