Transcript: Human XM_017006630.1

PREDICTED: Homo sapiens plexin B1 (PLXNB1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLXNB1 (5364)
Length:
7121
CDS:
79..6489

Additional Resources:

NCBI RefSeq record:
XM_017006630.1
NBCI Gene record:
PLXNB1 (5364)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006630.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236582 CATGCTCTTTCGAGGGATTAA pLKO_005 5202 CDS 100% 13.200 18.480 N PLXNB1 n/a
2 TRCN0000236585 CGACGTGCAAACATCTGATAA pLKO_005 6072 CDS 100% 13.200 18.480 N PLXNB1 n/a
3 TRCN0000236584 CTGCCACATCCTAGGTCTAAG pLKO_005 6930 3UTR 100% 10.800 15.120 N PLXNB1 n/a
4 TRCN0000061533 CGTGCAAACATCTGATAACAT pLKO.1 6075 CDS 100% 5.625 7.875 N PLXNB1 n/a
5 TRCN0000061537 GTGGCCTACATCGAGTATGAT pLKO.1 1135 CDS 100% 5.625 7.875 N PLXNB1 n/a
6 TRCN0000236586 CATGGGAAGCTTGAGTATTTC pLKO_005 5014 CDS 100% 13.200 9.240 N PLXNB1 n/a
7 TRCN0000236583 TCAGTGGAGGACGTGAGATAT pLKO_005 3869 CDS 100% 13.200 9.240 N PLXNB1 n/a
8 TRCN0000061535 CCCGATCAACAAACTTCTGTA pLKO.1 6174 CDS 100% 4.950 3.465 N PLXNB1 n/a
9 TRCN0000061534 GCTTGAGTATTTCACTGACAT pLKO.1 5022 CDS 100% 4.950 3.465 N PLXNB1 n/a
10 TRCN0000061536 CCAACTGCATTCACTCCCAAT pLKO.1 151 CDS 100% 4.050 2.835 N PLXNB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006630.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11036 pDONR223 100% 3.8% 3.6% None (many diffs) n/a
2 ccsbBroad304_11036 pLX_304 0% 3.8% 3.6% V5 (many diffs) n/a
Download CSV