Transcript: Human XM_017006640.1

PREDICTED: Homo sapiens 5'-3' exoribonuclease 1 (XRN1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XRN1 (54464)
Length:
10101
CDS:
119..5200

Additional Resources:

NCBI RefSeq record:
XM_017006640.1
NBCI Gene record:
XRN1 (54464)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006640.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296741 CGATGTTGTACAAGGTATAAA pLKO_005 1988 CDS 100% 15.000 21.000 N XRN1 n/a
2 TRCN0000329112 CGATGTTGTACAAGGTATAAA pLKO_005 1988 CDS 100% 15.000 21.000 N Xrn1 n/a
3 TRCN0000049675 CCGATGTACTATTTGAAGTAT pLKO.1 3525 CDS 100% 5.625 7.875 N XRN1 n/a
4 TRCN0000049673 CGCATTATTAAACCCAGGAAA pLKO.1 335 CDS 100% 4.950 3.960 N XRN1 n/a
5 TRCN0000296760 ACACTATCATTGAGGAATAAT pLKO_005 5586 3UTR 100% 15.000 10.500 N XRN1 n/a
6 TRCN0000049677 CCCAATCTTGATGCTTTAATA pLKO.1 2801 CDS 100% 15.000 10.500 N XRN1 n/a
7 TRCN0000290746 CCCAATCTTGATGCTTTAATA pLKO_005 2801 CDS 100% 15.000 10.500 N XRN1 n/a
8 TRCN0000296739 GTTACTCACAGGTCGTAAATA pLKO_005 2515 CDS 100% 15.000 10.500 N XRN1 n/a
9 TRCN0000296746 TATTGATGAGAAGCGATTATT pLKO_005 1822 CDS 100% 15.000 10.500 N XRN1 n/a
10 TRCN0000049674 GCTGGTATTATCCTTATCATT pLKO.1 1551 CDS 100% 5.625 3.938 N XRN1 n/a
11 TRCN0000119942 GCCTCTTCTTTATGGAACATA pLKO.1 1039 CDS 100% 5.625 3.375 N Xrn1 n/a
12 TRCN0000049676 CCAGCCAGATTCTTCCAACAT pLKO.1 4981 CDS 100% 4.950 2.970 N XRN1 n/a
13 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 7275 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006640.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.