Transcript: Human XM_017006645.2

PREDICTED: Homo sapiens leucine zipper transcription factor like 1 (LZTFL1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LZTFL1 (54585)
Length:
3936
CDS:
649..1575

Additional Resources:

NCBI RefSeq record:
XM_017006645.2
NBCI Gene record:
LZTFL1 (54585)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006645.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015139 GCAGCTTATCGAAACATGAAA pLKO.1 1480 CDS 100% 5.625 7.875 N LZTFL1 n/a
2 TRCN0000015138 GCCTATACCAATGTGTTACTT pLKO.1 904 CDS 100% 5.625 7.875 N LZTFL1 n/a
3 TRCN0000015140 GCCCAAGACTTAAGTAACTTA pLKO.1 1288 CDS 100% 5.625 4.500 N LZTFL1 n/a
4 TRCN0000413801 TTAGAACTAGAGTTCCTATTT pLKO_005 1703 3UTR 100% 13.200 9.240 N LZTFL1 n/a
5 TRCN0000431772 TGGAACAGCAGAACTCCTAAA pLKO_005 1107 CDS 100% 10.800 7.560 N LZTFL1 n/a
6 TRCN0000015141 CCATTGAAATACAGGCTACAA pLKO.1 1184 CDS 100% 4.950 3.465 N LZTFL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006645.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03440 pDONR223 100% 87.7% 83.8% None (many diffs) n/a
2 ccsbBroad304_03440 pLX_304 0% 87.7% 83.8% V5 (many diffs) n/a
3 TRCN0000465884 CCGAACCATAATTAGGCGGTCATG pLX_317 45.4% 87.7% 83.8% V5 (many diffs) n/a
4 ccsbBroadEn_08395 pDONR223 100% 87.3% 82.9% None (many diffs) n/a
5 ccsbBroad304_08395 pLX_304 0% 87.3% 82.9% V5 (many diffs) n/a
6 TRCN0000469753 GGATATGCGTCTAGCGCAAAACCG pLX_317 50.1% 87.3% 82.9% V5 (many diffs) n/a
Download CSV