Transcript: Human XM_017006780.1

PREDICTED: Homo sapiens SET domain containing 5 (SETD5), transcript variant X24, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SETD5 (55209)
Length:
7157
CDS:
1054..5106

Additional Resources:

NCBI RefSeq record:
XM_017006780.1
NBCI Gene record:
SETD5 (55209)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006780.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098703 GCCATCAGACTTACGGACTAT pLKO.1 4923 CDS 100% 4.950 6.930 N Setd5 n/a
2 TRCN0000098704 CCCAAACACTACATTCGCTTT pLKO.1 2974 CDS 100% 4.050 5.670 N Setd5 n/a
3 TRCN0000253863 AGACTTGTTGAGCCCATTAAA pLKO_005 3195 CDS 100% 15.000 10.500 N SETD5 n/a
4 TRCN0000253862 CAACCGTGCTGCATCTAAATA pLKO_005 2787 CDS 100% 15.000 10.500 N SETD5 n/a
5 TRCN0000253861 AGCGTGTATTCCACTCATAAT pLKO_005 791 5UTR 100% 13.200 9.240 N SETD5 n/a
6 TRCN0000253860 TTGTGGGCAAACCTACTATTT pLKO_005 1448 CDS 100% 13.200 9.240 N SETD5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006780.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12183 pDONR223 100% 68.4% 68.4% None 1_1221del;2389_2445del n/a
2 ccsbBroad304_12183 pLX_304 0% 68.4% 68.4% V5 1_1221del;2389_2445del n/a
3 TRCN0000471018 TCACCTGCGTAGGGTTCCCTTGAC pLX_317 15.3% 68.4% 68.4% V5 1_1221del;2389_2445del n/a
Download CSV