Transcript: Human XM_017006787.2

PREDICTED: Homo sapiens protein phosphatase 2 regulatory subunit B''alpha (PPP2R3A), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPP2R3A (5523)
Length:
8252
CDS:
618..3803

Additional Resources:

NCBI RefSeq record:
XM_017006787.2
NBCI Gene record:
PPP2R3A (5523)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006871 CCACGGTTATTCAGAGAATAT pLKO.1 2890 CDS 100% 13.200 18.480 N PPP2R3A n/a
2 TRCN0000356363 TTGACTTAGCCCTAGTAATAA pLKO_005 4255 3UTR 100% 15.000 10.500 N PPP2R3A n/a
3 TRCN0000356365 TGTAGATCTTGAGCCTAAATC pLKO_005 2270 CDS 100% 13.200 9.240 N PPP2R3A n/a
4 TRCN0000356288 CCGATCTGTCTCGATACAATG pLKO_005 3112 CDS 100% 10.800 7.560 N PPP2R3A n/a
5 TRCN0000006872 GCAGGATTATTGAAAGGATAT pLKO.1 3148 CDS 100% 10.800 7.560 N PPP2R3A n/a
6 TRCN0000006874 CCACACCTTCACACATGGAAT pLKO.1 722 CDS 100% 4.950 3.465 N PPP2R3A n/a
7 TRCN0000006870 GCCTAGAAGAAACCTTCACTT pLKO.1 4176 3UTR 100% 4.950 3.465 N PPP2R3A n/a
8 TRCN0000006873 GCCTCTAAATTCATCTGTCTT pLKO.1 2742 CDS 100% 4.950 3.465 N PPP2R3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06760 pDONR223 100% 92.2% 92.1% None 1992_1993ins267;3035A>G n/a
2 ccsbBroad304_06760 pLX_304 0% 92.2% 92.1% V5 1992_1993ins267;3035A>G n/a
Download CSV