Transcript: Human XM_017006839.2

PREDICTED: Homo sapiens N-glycanase 1 (NGLY1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NGLY1 (55768)
Length:
2260
CDS:
54..1829

Additional Resources:

NCBI RefSeq record:
XM_017006839.2
NBCI Gene record:
NGLY1 (55768)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006839.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304166 ATTACTTCGAGACACTATTAA pLKO_005 1277 CDS 100% 15.000 21.000 N NGLY1 n/a
2 TRCN0000304238 TTGATGTCACTTGGCGATATT pLKO_005 1207 CDS 100% 13.200 10.560 N NGLY1 n/a
3 TRCN0000118218 GCTCCACCTTTGTTACAATAT pLKO.1 1529 CDS 100% 13.200 9.240 N NGLY1 n/a
4 TRCN0000370500 AGATCGTTATGTTCGAGTTTC pLKO_005 1556 CDS 100% 10.800 7.560 N NGLY1 n/a
5 TRCN0000118221 CTTTCCTATGTCATAGCATTT pLKO.1 1170 CDS 100% 10.800 7.560 N NGLY1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006839.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03651 pDONR223 100% 86.8% 84.1% None (many diffs) n/a
2 ccsbBroad304_03651 pLX_304 0% 86.8% 84.1% V5 (many diffs) n/a
3 TRCN0000472129 TATAAATTGAGAACTGTCATTTCC pLX_317 21.3% 86.8% 84.1% V5 (many diffs) n/a
Download CSV