Transcript: Human XM_017007083.1

PREDICTED: Homo sapiens SH3 and cysteine rich domain (STAC), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STAC (6769)
Length:
2956
CDS:
234..1238

Additional Resources:

NCBI RefSeq record:
XM_017007083.1
NBCI Gene record:
STAC (6769)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007083.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136585 CCACATGATAGTGGGAACAAA pLKO.1 404 CDS 100% 5.625 7.875 N STAC n/a
2 TRCN0000138789 GACCAAGAGTTTACGGAGCAA pLKO.1 173 5UTR 100% 2.640 3.696 N STAC n/a
3 TRCN0000138733 CCAGCCAACTTTGTTCAGAGA pLKO.1 1032 CDS 100% 2.640 2.112 N STAC n/a
4 TRCN0000105762 CCCATTACAGATGAACACCTA pLKO.1 878 CDS 100% 2.640 2.112 N Stac n/a
5 TRCN0000416312 ATCCATGTAGCTAAGTATTAT pLKO_005 1614 3UTR 100% 15.000 10.500 N STAC n/a
6 TRCN0000426287 GAACAGTTTGGCTGCATTAAA pLKO_005 564 CDS 100% 15.000 10.500 N STAC n/a
7 TRCN0000427649 AGATCCAGCGAAGAACATAAA pLKO_005 833 CDS 100% 13.200 9.240 N STAC n/a
8 TRCN0000431380 ATGTTGCCTTGTACAAATTTG pLKO_005 898 CDS 100% 13.200 9.240 N STAC n/a
9 TRCN0000137346 GCAGGACATGAGACATAGATA pLKO.1 1961 3UTR 100% 5.625 3.938 N STAC n/a
10 TRCN0000133742 CCAGGAGACATAATTACTCTT pLKO.1 951 CDS 100% 4.950 3.465 N STAC n/a
11 TRCN0000138152 CCACTTTCTGTGATGTCTGCA pLKO.1 382 CDS 100% 2.640 1.848 N STAC n/a
12 TRCN0000134576 GCATTAAAGAAGTTATGCCCA pLKO.1 577 CDS 100% 0.660 0.462 N STAC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007083.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07007 pDONR223 100% 83% 82.8% None 0_1ins204;129G>T n/a
2 ccsbBroad304_07007 pLX_304 0% 83% 82.8% V5 0_1ins204;129G>T n/a
3 TRCN0000492333 ACCAGCCGCGCTTCTGCTGAAATT pLX_317 34.9% 83% 82.8% V5 0_1ins204;129G>T n/a
Download CSV