Transcript: Human XM_017007194.1

PREDICTED: Homo sapiens zinc finger protein 385D (ZNF385D), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF385D (79750)
Length:
4484
CDS:
394..1689

Additional Resources:

NCBI RefSeq record:
XM_017007194.1
NBCI Gene record:
ZNF385D (79750)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007194.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430133 CGATTCAGAAAGCTGTAATAA pLKO_005 617 CDS 100% 15.000 21.000 N ZNF385D n/a
2 TRCN0000426365 GAGTAATTGTACTGCAATAAT pLKO_005 1701 3UTR 100% 15.000 12.000 N ZNF385D n/a
3 TRCN0000414889 ACCGAAGAAAGCAAATCATAT pLKO_005 665 CDS 100% 13.200 9.240 N ZNF385D n/a
4 TRCN0000434718 ACTCGGAAACGCAACTTAAAC pLKO_005 1331 CDS 100% 13.200 9.240 N ZNF385D n/a
5 TRCN0000135670 GAATGGAAGTGGCACTATCAA pLKO.1 1206 CDS 100% 5.625 3.938 N ZNF385D n/a
6 TRCN0000138157 CTTTGCAACCATCGCTGGATA pLKO.1 521 CDS 100% 4.950 3.465 N ZNF385D n/a
7 TRCN0000136252 GCAATAGCTCATGTCCTTCTA pLKO.1 1058 CDS 100% 4.950 3.465 N ZNF385D n/a
8 TRCN0000138641 CAAAGGCACGAAACATGCCAA pLKO.1 741 CDS 100% 2.640 1.848 N ZNF385D n/a
9 TRCN0000135426 GCAGAAATCTGTAACTGCCAA pLKO.1 795 CDS 100% 2.640 1.848 N ZNF385D n/a
10 TRCN0000136502 CAACAGTGGTACTAAGCACAA pLKO.1 1167 CDS 100% 4.050 2.430 N ZNF385D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007194.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10467 pDONR223 100% 89.8% 90.4% None (many diffs) n/a
2 ccsbBroad304_10467 pLX_304 0% 89.8% 90.4% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV