Transcript: Human XM_017007315.1

PREDICTED: Homo sapiens beaded filament structural protein 2 (BFSP2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BFSP2 (8419)
Length:
3450
CDS:
2203..3450

Additional Resources:

NCBI RefSeq record:
XM_017007315.1
NBCI Gene record:
BFSP2 (8419)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007315.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116363 GCCGGAGCAGATGACTTTAAA pLKO.1 2749 CDS 100% 15.000 21.000 N BFSP2 n/a
2 TRCN0000435534 AGTCATTGATGAGGCTAATTT pLKO_005 2835 CDS 100% 15.000 10.500 N BFSP2 n/a
3 TRCN0000116366 CAGTGGGAGAGAGATGTTGAA pLKO.1 3034 CDS 100% 4.950 3.465 N BFSP2 n/a
4 TRCN0000116364 CATCCTTGAGACGATCAGAAT pLKO.1 3012 CDS 100% 4.950 3.465 N BFSP2 n/a
5 TRCN0000413760 GAACTTGGCTCTCTATCAAGA pLKO_005 2899 CDS 100% 4.950 3.465 N BFSP2 n/a
6 TRCN0000116365 GAGTCAAATAGAAAGTCTGAA pLKO.1 2874 CDS 100% 4.950 3.465 N BFSP2 n/a
7 TRCN0000424548 GGTGGAATATATGGCCAAAGT pLKO_005 2547 CDS 100% 4.950 3.465 N BFSP2 n/a
8 TRCN0000428536 TCAGGGTGGAGTTACACAACA pLKO_005 3152 CDS 100% 4.950 3.465 N BFSP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007315.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01926 pDONR223 100% 99.8% 100% None 603G>A;1245G>C n/a
2 ccsbBroad304_01926 pLX_304 0% 99.8% 100% V5 603G>A;1245G>C n/a
3 TRCN0000479251 GAGCCATAGAGTGGACTCTTCCGC pLX_317 44.7% 99.8% 100% V5 603G>A;1245G>C n/a
Download CSV