Transcript: Human XM_017007463.1

PREDICTED: Homo sapiens solute carrier family 33 member 1 (SLC33A1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC33A1 (9197)
Length:
3887
CDS:
1056..2195

Additional Resources:

NCBI RefSeq record:
XM_017007463.1
NBCI Gene record:
SLC33A1 (9197)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310223 GGACTCTTCATGATCTATTTA pLKO_005 884 5UTR 100% 15.000 21.000 N SLC33A1 n/a
2 TRCN0000296497 TACAGCCCTGGATGGTTATTA pLKO_005 2057 CDS 100% 15.000 21.000 N SLC33A1 n/a
3 TRCN0000042922 CTGCTGAGTTATGCTTTACAT pLKO.1 1788 CDS 100% 5.625 7.875 N SLC33A1 n/a
4 TRCN0000310222 ATCAGTGCACAGGAGTATAAA pLKO_005 2262 3UTR 100% 15.000 10.500 N SLC33A1 n/a
5 TRCN0000296496 AGGTTAGTGATCCACTTATTG pLKO_005 1858 CDS 100% 13.200 9.240 N SLC33A1 n/a
6 TRCN0000042918 GCCTCTGATTATCAGCAAATA pLKO.1 1622 CDS 100% 13.200 9.240 N SLC33A1 n/a
7 TRCN0000042919 CCTTCTGATTCTAACTGCAAA pLKO.1 1487 CDS 100% 4.950 3.465 N SLC33A1 n/a
8 TRCN0000042921 CTACTCTTTCTTTACGTGCTT pLKO.1 662 5UTR 100% 2.640 1.848 N SLC33A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02104 pDONR223 100% 58% 52.6% None 0_1ins625;149_263del n/a
2 ccsbBroad304_02104 pLX_304 0% 58% 52.6% V5 0_1ins625;149_263del n/a
3 TRCN0000474996 TTTTATCCTGCCAGCTCTTGTGTT pLX_317 3.7% 58% 52.6% V5 0_1ins625;149_263del n/a
Download CSV