Transcript: Human XM_017007541.1

PREDICTED: Homo sapiens vestigial like family member 4 (VGLL4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VGLL4 (9686)
Length:
3546
CDS:
172..1059

Additional Resources:

NCBI RefSeq record:
XM_017007541.1
NBCI Gene record:
VGLL4 (9686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007541.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144954 GCGTAAAGAATGTACAGAGAA pLKO.1 2871 3UTR 100% 4.950 6.930 N VGLL4 n/a
2 TRCN0000231110 ACACGTGGCTCCAGATCAAAG pLKO_005 926 CDS 100% 10.800 8.640 N VGLL4 n/a
3 TRCN0000122864 GACAACGACCACGTCTCCAAA pLKO.1 394 CDS 100% 4.950 3.960 N VGLL4 n/a
4 TRCN0000145125 GCAGGCTGACATCATTTATTT pLKO.1 2135 3UTR 100% 15.000 10.500 N VGLL4 n/a
5 TRCN0000231109 CAGGAGCCTGGGCAAGAATTA pLKO_005 828 CDS 100% 13.200 9.240 N VGLL4 n/a
6 TRCN0000218084 GAAGTCTCATACAGGTTATAG pLKO_005 1712 3UTR 100% 13.200 9.240 N VGLL4 n/a
7 TRCN0000231108 ATCTGAACAAGACTGCCAATG pLKO_005 437 CDS 100% 6.000 4.200 N VGLL4 n/a
8 TRCN0000139641 CCTGCCTCAGTTACCAAAGAA pLKO.1 1308 3UTR 100% 5.625 3.938 N VGLL4 n/a
9 TRCN0000145467 GCCTGACAACTTTATGTGTTA pLKO.1 1564 3UTR 100% 4.950 3.465 N VGLL4 n/a
10 TRCN0000231107 TGGTGCATGCTGATGACGAAA pLKO_005 94 5UTR 100% 4.950 3.465 N VGLL4 n/a
11 TRCN0000139733 CAAGAGGAAGTTCAGCATGGA pLKO.1 348 CDS 100% 2.640 1.848 N VGLL4 n/a
12 TRCN0000139406 CAGCAAGAGGAAGTTCAGCAT pLKO.1 345 CDS 100% 2.640 1.848 N VGLL4 n/a
13 TRCN0000122510 CCATCTGAACAAGACTGCCAA pLKO.1 435 CDS 100% 2.640 1.848 N VGLL4 n/a
14 TRCN0000140553 GCTTTCTCAGTCACAAGCCAT pLKO.1 1376 3UTR 100% 2.640 1.848 N VGLL4 n/a
15 TRCN0000139816 CCTTACTTCCTGCCTCAGTTA pLKO.1 1300 3UTR 100% 4.950 2.970 N VGLL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007541.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07466 pDONR223 100% 93.6% 91.8% None (many diffs) n/a
2 ccsbBroad304_07466 pLX_304 0% 93.6% 91.8% V5 (many diffs) n/a
3 TRCN0000467980 TATGCCTATGACTCGCAAGTTGCG pLX_317 34.3% 93.6% 91.8% V5 (many diffs) n/a
Download CSV