Transcript: Human XM_017007720.1

PREDICTED: Homo sapiens sodium channel and clathrin linker 1 (SCLT1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCLT1 (132320)
Length:
2967
CDS:
921..2483

Additional Resources:

NCBI RefSeq record:
XM_017007720.1
NBCI Gene record:
SCLT1 (132320)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423027 GAGGTAGGAACTGACATATAT pLKO_005 768 5UTR 100% 15.000 21.000 N SCLT1 n/a
2 TRCN0000412856 GCCAAATTGAACGAGTCATTA pLKO_005 1654 CDS 100% 13.200 18.480 N SCLT1 n/a
3 TRCN0000429771 ATATGACTGAGGCCCAGATTC pLKO_005 919 5UTR 100% 10.800 15.120 N SCLT1 n/a
4 TRCN0000424884 TGTACAAGATGCTACCATAAG pLKO_005 1529 CDS 100% 10.800 15.120 N SCLT1 n/a
5 TRCN0000137249 GCCAACCAATTAAGAACCGAA pLKO.1 1308 CDS 100% 2.640 3.696 N SCLT1 n/a
6 TRCN0000414063 CAGACTTCAAAGGCGTCTAAG pLKO_005 2363 CDS 100% 10.800 8.640 N SCLT1 n/a
7 TRCN0000435022 GAAGCATCAGATAGGCGTTTA pLKO_005 1227 CDS 100% 10.800 8.640 N SCLT1 n/a
8 TRCN0000415145 GCAGTTACAGTCTAGTATAAA pLKO_005 1250 CDS 100% 15.000 10.500 N SCLT1 n/a
9 TRCN0000421651 TGACCACTTCCTGTAAGTAAA pLKO_005 2643 3UTR 100% 13.200 9.240 N SCLT1 n/a
10 TRCN0000431350 TCAATAAAGGAACGTGGATTT pLKO_005 2073 CDS 100% 10.800 7.560 N SCLT1 n/a
11 TRCN0000134982 CACTCACAGAACTTTAGAGTT pLKO.1 2498 3UTR 100% 4.950 3.465 N SCLT1 n/a
12 TRCN0000137303 GAAGAACTTTCAGCCCTTCAA pLKO.1 1611 CDS 100% 4.950 3.465 N SCLT1 n/a
13 TRCN0000137221 GCAGTTGGACTAGAAGTGTAT pLKO.1 2525 3UTR 100% 4.950 3.465 N SCLT1 n/a
14 TRCN0000134808 CAGAACTTTAGAGTTGGGAAA pLKO.1 2504 3UTR 100% 4.050 2.835 N SCLT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.