Transcript: Human XM_017007884.2

PREDICTED: Homo sapiens coagulation factor XI (F11), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
F11 (2160)
Length:
3722
CDS:
334..1521

Additional Resources:

NCBI RefSeq record:
XM_017007884.2
NBCI Gene record:
F11 (2160)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007884.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372203 TTGCCCAGTACACGCATTAAA pLKO_005 1123 CDS 100% 15.000 21.000 N F11 n/a
2 TRCN0000372148 AGAATAACGAAGCTCGATAAA pLKO_005 862 CDS 100% 13.200 18.480 N F11 n/a
3 TRCN0000372202 CTAGACATGAAGGGCATAAAC pLKO_005 685 CDS 100% 13.200 9.240 N F11 n/a
4 TRCN0000006795 GCCCAAAGAATCTCAAAGAAA pLKO.1 1071 CDS 100% 5.625 3.938 N F11 n/a
5 TRCN0000006793 CCACCCAAGATGTTTACTCTT pLKO.1 489 CDS 100% 4.950 3.465 N F11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007884.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00532 pDONR223 100% 61.5% 61% None (many diffs) n/a
2 ccsbBroad304_00532 pLX_304 0% 61.5% 61% V5 (many diffs) n/a
3 TRCN0000472376 TGTGGCCACCCTCCAAGCTGCCTG pLX_317 22.9% 61.5% 61% V5 (many diffs) n/a
Download CSV