Transcript: Human XM_017008018.2

PREDICTED: Homo sapiens signal transducing adaptor family member 1 (STAP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STAP1 (26228)
Length:
1220
CDS:
63..1007

Additional Resources:

NCBI RefSeq record:
XM_017008018.2
NBCI Gene record:
STAP1 (26228)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431213 GAACCCTTCTTTGGGAAATAT pLKO_005 641 CDS 100% 15.000 10.500 N STAP1 n/a
2 TRCN0000065085 GCCTGGTAGTGACAGTAGAAA pLKO.1 671 CDS 100% 5.625 3.938 N STAP1 n/a
3 TRCN0000065086 CCAACTGAAGATTATGTGGAT pLKO.1 552 CDS 100% 2.640 1.848 N STAP1 n/a
4 TRCN0000065084 GCTCTACCTTTGTACTTTGAA pLKO.1 129 CDS 100% 5.625 3.375 N STAP1 n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1056 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1056 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02933 pDONR223 100% 72.7% 60.3% None (many diffs) n/a
2 ccsbBroad304_02933 pLX_304 0% 72.7% 60.3% V5 (many diffs) n/a
3 TRCN0000491944 CCAGCCGGTCTCAAAACAGGCGGT pLX_317 36.7% 72.7% 60.3% V5 (many diffs) n/a
Download CSV