Transcript: Human XM_017008023.1

PREDICTED: Homo sapiens dual adaptor of phosphotyrosine and 3-phosphoinositides 1 (DAPP1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DAPP1 (27071)
Length:
961
CDS:
85..861

Additional Resources:

NCBI RefSeq record:
XM_017008023.1
NBCI Gene record:
DAPP1 (27071)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008023.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002603 TGTGCAAAGACCGGAGTAGAA pLKO.1 843 CDS 100% 4.950 3.960 N DAPP1 n/a
2 TRCN0000355743 GATGAGTGGATCAAGATATTA pLKO_005 867 3UTR 100% 15.000 10.500 N DAPP1 n/a
3 TRCN0000355796 AGCTGTACAATTCGATTATTC pLKO_005 726 CDS 100% 13.200 9.240 N DAPP1 n/a
4 TRCN0000002601 GTGAGGGCCAAAGATTCTGTT pLKO.1 304 CDS 100% 4.950 3.465 N DAPP1 n/a
5 TRCN0000002602 GCAGACAGGAAGAACAGAAGA pLKO.1 528 CDS 100% 4.950 2.970 N DAPP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008023.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491823 CAATCCAGATACCGGCCCTCTAGG pLX_317 36% 83.2% 79.7% V5 (not translated due to prior stop codon) 686_726del;774_775ins107 n/a
Download CSV