Transcript: Human XM_017008163.1

PREDICTED: Homo sapiens alpha-L-iduronidase (IDUA), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IDUA (3425)
Length:
2630
CDS:
1503..2504

Additional Resources:

NCBI RefSeq record:
XM_017008163.1
NBCI Gene record:
IDUA (3425)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008163.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369816 CGCTCCTGAGCAACGACAATG pLKO_005 1573 CDS 100% 3.600 5.040 N IDUA n/a
2 TRCN0000244204 GGAACTTCGAGACGTGGAATG pLKO_005 1038 5UTR 100% 6.000 4.800 N IDUA n/a
3 TRCN0000244417 AGGACAAGCAGCAGGTGTTTG pLKO_005 467 5UTR 100% 10.800 7.560 N IDUA n/a
4 TRCN0000244416 TCCAAGTGCCTGTGGACATAC pLKO_005 2265 CDS 100% 10.800 7.560 N IDUA n/a
5 TRCN0000244415 CAGTTCTCTCAGGACGGTAAG pLKO_005 2292 CDS 100% 6.000 4.200 N IDUA n/a
6 TRCN0000029234 CCATCGACCTTCAACCTCTTT pLKO.1 2337 CDS 100% 4.950 3.465 N IDUA n/a
7 TRCN0000029235 GCATGTTTCCAAGTGGAACTT pLKO.1 1024 5UTR 100% 4.950 3.465 N IDUA n/a
8 TRCN0000244414 GTTCTGGTCTGGTCGGATGAA pLKO_005 2235 CDS 100% 4.950 3.465 N IDUA n/a
9 TRCN0000029238 GTGGACATACGAGATCCAGTT pLKO.1 2276 CDS 100% 4.050 2.835 N IDUA n/a
10 TRCN0000369888 ACGACTTTGACAACGTCTCCA pLKO_005 1071 5UTR 100% 2.640 1.848 N IDUA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008163.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.