Transcript: Human XM_017008286.1

PREDICTED: Homo sapiens phosphodiesterase 6B (PDE6B), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDE6B (5158)
Length:
2665
CDS:
252..1979

Additional Resources:

NCBI RefSeq record:
XM_017008286.1
NBCI Gene record:
PDE6B (5158)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008286.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437357 ACGTGGCAGAAAGCGGCTTTA pLKO_005 454 CDS 100% 10.800 15.120 N PDE6B n/a
2 TRCN0000048982 CGGGAAATTGTCTTCTACAAA pLKO.1 339 CDS 100% 5.625 7.875 N PDE6B n/a
3 TRCN0000048978 CGCTGACGAAATGTTCAAATT pLKO.1 497 CDS 100% 13.200 10.560 N PDE6B n/a
4 TRCN0000415731 ATAAACTGTAGCCTACATTAC pLKO_005 2442 3UTR 100% 10.800 7.560 N PDE6B n/a
5 TRCN0000048980 GCCCACCACATTTGACATCTA pLKO.1 899 CDS 100% 4.950 3.465 N PDE6B n/a
6 TRCN0000048979 GCTGATGAGTATGAGGCCAAA pLKO.1 1845 CDS 100% 4.050 2.835 N PDE6B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008286.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06707 pDONR223 100% 67.1% 66.9% None (many diffs) n/a
2 ccsbBroad304_06707 pLX_304 0% 67.1% 66.9% V5 (many diffs) n/a
3 TRCN0000480207 ACTACTCATTGCCAGGTTCCCCAC pLX_317 16.3% 67.1% 66.9% V5 (many diffs) n/a
Download CSV