Transcript: Human XM_017008356.1

PREDICTED: Homo sapiens leucine rich repeat LGI family member 2 (LGI2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LGI2 (55203)
Length:
1001
CDS:
2..865

Additional Resources:

NCBI RefSeq record:
XM_017008356.1
NBCI Gene record:
LGI2 (55203)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008356.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139471 CAGCTGTACCAAGGAGTCTAT pLKO.1 121 CDS 100% 4.950 3.960 N LGI2 n/a
2 TRCN0000144559 GACTCTCTGATTGAACTAGAT pLKO.1 470 CDS 100% 4.950 3.960 N LGI2 n/a
3 TRCN0000138972 CCGTTTCTGATGTGCTGTGTA pLKO.1 564 CDS 100% 4.950 3.465 N LGI2 n/a
4 TRCN0000145222 GAAATGAATTTCCGGAGCTAT pLKO.1 788 CDS 100% 4.950 3.465 N LGI2 n/a
5 TRCN0000177840 CCTGTTCATTGAAGGGAACAA pLKO.1 340 CDS 100% 0.495 0.347 N Lgi2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008356.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08490 pDONR223 100% 51.9% 49.7% None (many diffs) n/a
2 ccsbBroad304_08490 pLX_304 0% 51.9% 49.7% V5 (many diffs) n/a
3 TRCN0000481617 CACACCCCACCATCCCGGGATTTC pLX_317 27.3% 51.9% 49.7% V5 (many diffs) n/a
Download CSV