Transcript: Human XM_017008407.2

PREDICTED: Homo sapiens exocyst complex component 1 (EXOC1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EXOC1 (55763)
Length:
2081
CDS:
306..2015

Additional Resources:

NCBI RefSeq record:
XM_017008407.2
NBCI Gene record:
EXOC1 (55763)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129847 CCCGACTATATGAAAGAGAAA pLKO.1 1603 CDS 100% 4.950 6.930 N EXOC1 n/a
2 TRCN0000435030 GATCTACTTCTAGTCTAAATA pLKO_005 1765 CDS 100% 15.000 12.000 N EXOC1 n/a
3 TRCN0000428430 GATGAATACCAAGAGTTAAAT pLKO_005 777 CDS 100% 15.000 10.500 N EXOC1 n/a
4 TRCN0000420239 GAAGAACAGGATATCGAAATA pLKO_005 804 CDS 100% 13.200 9.240 N EXOC1 n/a
5 TRCN0000423678 CATAGAGATTTGCTCCGATAT pLKO_005 1503 CDS 100% 10.800 7.560 N EXOC1 n/a
6 TRCN0000128329 GAAAGCAACCACCTAATTCAT pLKO.1 1065 CDS 100% 5.625 3.938 N EXOC1 n/a
7 TRCN0000127517 CAGTCAATCATGGCATCTGAA pLKO.1 918 CDS 100% 4.950 3.465 N EXOC1 n/a
8 TRCN0000127717 GAGTGGCTAAAGAGTACAGAT pLKO.1 1536 CDS 100% 4.950 3.465 N EXOC1 n/a
9 TRCN0000131016 CCAGTCAATCATGGCATCTGA pLKO.1 917 CDS 100% 3.000 2.100 N EXOC1 n/a
10 TRCN0000130652 CCTGTTGGATATGGGAAACAT pLKO.1 1832 CDS 100% 5.625 3.375 N EXOC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08582 pDONR223 100% 60.1% 60.1% None (many diffs) n/a
2 ccsbBroad304_08582 pLX_304 0% 60.1% 60.1% V5 (many diffs) n/a
3 TRCN0000477377 GATACTTTAGACAAAGATTTATGT pLX_317 13.6% 60.1% 60.1% V5 (many diffs) n/a
Download CSV