Transcript: Human XM_017008546.1

PREDICTED: Homo sapiens N-deacetylase and N-sulfotransferase 4 (NDST4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NDST4 (64579)
Length:
5296
CDS:
121..1602

Additional Resources:

NCBI RefSeq record:
XM_017008546.1
NBCI Gene record:
NDST4 (64579)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008546.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358949 ATGACCGCCTAGGGTTATATA pLKO_005 557 CDS 100% 15.000 21.000 N NDST4 n/a
2 TRCN0000359032 GGGAGTTACACCTCGTTATAA pLKO_005 1341 CDS 100% 15.000 21.000 N NDST4 n/a
3 TRCN0000036089 CGGTACAGAAAGGGCTTCATT pLKO.1 355 CDS 100% 5.625 4.500 N NDST4 n/a
4 TRCN0000036090 CGAGATCATAATGTGGAACTA pLKO.1 1510 CDS 100% 4.950 3.465 N NDST4 n/a
5 TRCN0000036092 GCATCCTTCAATCATCAGCAA pLKO.1 831 CDS 100% 2.640 1.848 N NDST4 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5019 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008546.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07396 pDONR223 100% 45.6% 49.9% None (many diffs) n/a
2 ccsbBroad304_07396 pLX_304 0% 45.6% 49.9% V5 (many diffs) n/a
3 TRCN0000491282 ACGTAGTCCTAAACAGAATCCTGA pLX_317 10.9% 45.6% 49.9% V5 (many diffs) n/a
Download CSV