Transcript: Human XM_017008557.2

PREDICTED: Homo sapiens ubiquitin specific peptidase 46 (USP46), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP46 (64854)
Length:
7976
CDS:
148..1173

Additional Resources:

NCBI RefSeq record:
XM_017008557.2
NBCI Gene record:
USP46 (64854)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008557.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350480 CGTGGGCATTATATCACTATT pLKO_005 1078 CDS 100% 13.200 18.480 N USP46 n/a
2 TRCN0000022402 GCTAAACACTATTGCGGACAT pLKO.1 531 CDS 100% 4.050 5.670 N USP46 n/a
3 TRCN0000315060 GCTAAACACTATTGCGGACAT pLKO_005 531 CDS 100% 4.050 5.670 N USP46 n/a
4 TRCN0000022401 CGCTTACCAATGAAACTCGAT pLKO.1 671 CDS 100% 2.640 3.696 N USP46 n/a
5 TRCN0000350404 CGCTTACCAATGAAACTCGAT pLKO_005 671 CDS 100% 2.640 3.696 N USP46 n/a
6 TRCN0000315062 CTATGGCCTGACGTCAGATAT pLKO_005 1235 3UTR 100% 13.200 10.560 N USP46 n/a
7 TRCN0000315061 TTCAGTCTGACATAGAGTTAA pLKO_005 1490 3UTR 100% 13.200 9.240 N USP46 n/a
8 TRCN0000022400 CCAGAGCAGTTTCCAATCAAT pLKO.1 220 CDS 100% 5.625 3.938 N USP46 n/a
9 TRCN0000022399 GACAGAAGAATTGGGTAGATA pLKO.1 1756 3UTR 100% 5.625 3.938 N USP46 n/a
10 TRCN0000022403 AGCAAACAAGAAGCCCAGAAA pLKO.1 847 CDS 100% 4.950 3.465 N USP46 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6339 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 6215 3UTR 100% 2.640 1.320 Y LINC01098 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6339 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008557.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08876 pDONR223 100% 92.4% 91.5% None (many diffs) n/a
2 ccsbBroad304_08876 pLX_304 0% 92.4% 91.5% V5 (many diffs) n/a
3 TRCN0000481093 AAGTTCAGCCCTGAACCCGCATGT pLX_317 43.7% 92.4% 91.5% V5 (many diffs) n/a
Download CSV