Transcript: Human XM_017008613.1

PREDICTED: Homo sapiens NOP2/Sun RNA methyltransferase family member 7 (NSUN7), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NSUN7 (79730)
Length:
2022
CDS:
519..1949

Additional Resources:

NCBI RefSeq record:
XM_017008613.1
NBCI Gene record:
NSUN7 (79730)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008613.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428683 ATGATGTCTTAATGGTCAATA pLKO_005 1399 CDS 100% 13.200 18.480 N NSUN7 n/a
2 TRCN0000439033 GGCTATCCGGACTCCGTTTAT pLKO_005 639 CDS 100% 13.200 18.480 N NSUN7 n/a
3 TRCN0000134498 GTGGATCAACATTGCTATGAT pLKO.1 1245 CDS 100% 5.625 4.500 N NSUN7 n/a
4 TRCN0000137564 CGAAGAAGATCCCGAGATCAT pLKO.1 554 CDS 100% 4.950 3.960 N NSUN7 n/a
5 TRCN0000134663 GTTGTTAAGAAAGCACTGGAA pLKO.1 1863 CDS 100% 2.640 1.848 N NSUN7 n/a
6 TRCN0000138344 CGAATCAAGCATGATGCCCTT pLKO.1 1044 CDS 100% 2.160 1.512 N NSUN7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008613.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12604 pDONR223 100% 97.9% 98.1% None (many diffs) n/a
2 ccsbBroad304_12604 pLX_304 0% 97.9% 98.1% V5 (many diffs) n/a
3 TRCN0000473758 ACTGGGCTGGGAAATTGCTTCGAA pLX_317 38.1% 97.9% 98.1% V5 (many diffs) n/a
Download CSV