Transcript: Human XM_017008666.1

PREDICTED: Homo sapiens factor interacting with PAPOLA and CPSF1 (FIP1L1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FIP1L1 (81608)
Length:
5021
CDS:
217..1887

Additional Resources:

NCBI RefSeq record:
XM_017008666.1
NBCI Gene record:
FIP1L1 (81608)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123578 CCATCTCTTATACCAACAATA pLKO.1 1306 CDS 100% 13.200 18.480 N Fip1l1 n/a
2 TRCN0000294384 GATGTTATCGGTCAGACTATA pLKO_005 1045 CDS 100% 13.200 18.480 N FIP1L1 n/a
3 TRCN0000306875 GGCCGAATCACCTGATCTAAG pLKO_005 1005 CDS 100% 10.800 15.120 N FIP1L1 n/a
4 TRCN0000123577 CGTCGCCATGAAAGTGAAGAA pLKO.1 1750 CDS 100% 4.950 6.930 N Fip1l1 n/a
5 TRCN0000332096 CGTCGCCATGAAAGTGAAGAA pLKO_005 1750 CDS 100% 4.950 6.930 N Fip1l1 n/a
6 TRCN0000074421 CCAGACATAAGTCTTCTCGAA pLKO.1 1718 CDS 100% 2.640 3.696 N FIP1L1 n/a
7 TRCN0000074419 CCTCTGGTTATGATAGTCGTT pLKO.1 1340 CDS 100% 2.640 3.696 N FIP1L1 n/a
8 TRCN0000307316 AGCAAGCAGTGGGACTATTAT pLKO_005 1444 CDS 100% 15.000 10.500 N FIP1L1 n/a
9 TRCN0000074422 CGAATGGGACTTGAAGTTATA pLKO.1 757 CDS 100% 13.200 9.240 N FIP1L1 n/a
10 TRCN0000294331 TCACTTAACAGGGAATCTAAA pLKO_005 2132 3UTR 100% 13.200 9.240 N FIP1L1 n/a
11 TRCN0000074420 CGATGAAGAACGATACAGATA pLKO.1 1602 CDS 100% 4.950 3.465 N FIP1L1 n/a
12 TRCN0000286978 CGATGAAGAACGATACAGATA pLKO_005 1602 CDS 100% 4.950 3.465 N FIP1L1 n/a
13 TRCN0000074418 GTACCAGAAGTAGATACTATA pLKO.1 1916 3UTR 100% 0.000 0.000 N FIP1L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16010 pDONR223 0% 92.2% 93.2% None (many diffs) n/a
2 ccsbBroad304_16010 pLX_304 0% 92.2% 93.2% V5 (many diffs) n/a
Download CSV