Transcript: Human XM_017008667.1

PREDICTED: Homo sapiens factor interacting with PAPOLA and CPSF1 (FIP1L1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FIP1L1 (81608)
Length:
4984
CDS:
195..1853

Additional Resources:

NCBI RefSeq record:
XM_017008667.1
NBCI Gene record:
FIP1L1 (81608)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123578 CCATCTCTTATACCAACAATA pLKO.1 1272 CDS 100% 13.200 18.480 N Fip1l1 n/a
2 TRCN0000294384 GATGTTATCGGTCAGACTATA pLKO_005 984 CDS 100% 13.200 18.480 N FIP1L1 n/a
3 TRCN0000123577 CGTCGCCATGAAAGTGAAGAA pLKO.1 1716 CDS 100% 4.950 6.930 N Fip1l1 n/a
4 TRCN0000332096 CGTCGCCATGAAAGTGAAGAA pLKO_005 1716 CDS 100% 4.950 6.930 N Fip1l1 n/a
5 TRCN0000074421 CCAGACATAAGTCTTCTCGAA pLKO.1 1684 CDS 100% 2.640 3.696 N FIP1L1 n/a
6 TRCN0000074419 CCTCTGGTTATGATAGTCGTT pLKO.1 1306 CDS 100% 2.640 3.696 N FIP1L1 n/a
7 TRCN0000307316 AGCAAGCAGTGGGACTATTAT pLKO_005 1410 CDS 100% 15.000 10.500 N FIP1L1 n/a
8 TRCN0000074422 CGAATGGGACTTGAAGTTATA pLKO.1 735 CDS 100% 13.200 9.240 N FIP1L1 n/a
9 TRCN0000294331 TCACTTAACAGGGAATCTAAA pLKO_005 2098 3UTR 100% 13.200 9.240 N FIP1L1 n/a
10 TRCN0000074420 CGATGAAGAACGATACAGATA pLKO.1 1568 CDS 100% 4.950 3.465 N FIP1L1 n/a
11 TRCN0000286978 CGATGAAGAACGATACAGATA pLKO_005 1568 CDS 100% 4.950 3.465 N FIP1L1 n/a
12 TRCN0000074418 GTACCAGAAGTAGATACTATA pLKO.1 1882 3UTR 100% 0.000 0.000 N FIP1L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16010 pDONR223 0% 81.5% 82.2% None (many diffs) n/a
2 ccsbBroad304_16010 pLX_304 0% 81.5% 82.2% V5 (many diffs) n/a
Download CSV