Transcript: Human XM_017008783.2

PREDICTED: Homo sapiens carbonyl reductase 4 (CBR4), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CBR4 (84869)
Length:
1613
CDS:
188..778

Additional Resources:

NCBI RefSeq record:
XM_017008783.2
NBCI Gene record:
CBR4 (84869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008783.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234666 GGTAAATGCAGCTGGTATTAA pLKO_005 427 CDS 100% 15.000 21.000 N CBR4 n/a
2 TRCN0000046398 GCGGAGATCATTTGGCATTTA pLKO.1 327 CDS 100% 13.200 18.480 N CBR4 n/a
3 TRCN0000234664 CAGAGCTGTGGCCCAGTTAAT pLKO_005 232 CDS 100% 13.200 9.240 N CBR4 n/a
4 TRCN0000234665 TGACCTCGGCGGAGATCATTT pLKO_005 319 CDS 100% 13.200 9.240 N CBR4 n/a
5 TRCN0000234667 CAACTCTGGCCAGTCCGTTTA pLKO_005 640 CDS 100% 10.800 7.560 N CBR4 n/a
6 TRCN0000046402 GCCAGTAAAGGAGGATTAGTT pLKO.1 665 CDS 100% 5.625 3.938 N CBR4 n/a
7 TRCN0000046401 GCTGCCATGAGGACTATGATT pLKO.1 536 CDS 100% 5.625 3.938 N CBR4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008783.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04435 pDONR223 100% 74.7% 72.4% None (many diffs) n/a
2 ccsbBroad304_04435 pLX_304 0% 74.7% 72.4% V5 (many diffs) n/a
3 TRCN0000474263 TACTCCCTCTCAGTCCGGCTGGTA pLX_317 79.7% 74.7% 72.4% V5 (many diffs) n/a
4 ccsbBroadEn_09231 pDONR223 100% 74.6% 72% None (many diffs) n/a
5 ccsbBroad304_09231 pLX_304 0% 74.6% 72% V5 (many diffs) n/a
6 TRCN0000470562 TTGTAGATAGGATCATCGACATTA pLX_317 51.8% 74.6% 72% V5 (many diffs) n/a
Download CSV