Transcript: Human XM_017008841.1

PREDICTED: Homo sapiens N-deacetylase and N-sulfotransferase 3 (NDST3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NDST3 (9348)
Length:
7930
CDS:
3223..4782

Additional Resources:

NCBI RefSeq record:
XM_017008841.1
NBCI Gene record:
NDST3 (9348)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035993 CGTTTGATTCTCATAAAGGTT pLKO.1 4481 CDS 100% 3.000 4.200 N NDST3 n/a
2 TRCN0000035992 GCGTGCACAAATCACAAATTT pLKO.1 3090 5UTR 100% 15.000 12.000 N NDST3 n/a
3 TRCN0000035990 CCCATTTCAGTTGCTAATTAT pLKO.1 4362 CDS 100% 15.000 10.500 N NDST3 n/a
4 TRCN0000035991 GCTTTGTATTTGTTCCTGGTT pLKO.1 3910 CDS 100% 2.640 1.848 N NDST3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07396 pDONR223 100% 54.5% 51.7% None 0_1ins1140;1362_1363insAGCAG;1475_1557del n/a
2 ccsbBroad304_07396 pLX_304 0% 54.5% 51.7% V5 0_1ins1140;1362_1363insAGCAG;1475_1557del n/a
3 TRCN0000491282 ACGTAGTCCTAAACAGAATCCTGA pLX_317 10.9% 54.5% 51.7% V5 0_1ins1140;1362_1363insAGCAG;1475_1557del n/a
Download CSV