Transcript: Human XM_017008876.1

PREDICTED: Homo sapiens G3BP stress granule assembly factor 2 (G3BP2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
G3BP2 (9908)
Length:
4245
CDS:
149..1597

Additional Resources:

NCBI RefSeq record:
XM_017008876.1
NBCI Gene record:
G3BP2 (9908)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008876.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415266 GTGATGATCGCAGGGATATTA pLKO_005 1410 CDS 100% 15.000 21.000 N G3BP2 n/a
2 TRCN0000047548 CGGGAGTTTGTGAGGCAATAT pLKO.1 185 CDS 100% 13.200 18.480 N G3BP2 n/a
3 TRCN0000417674 GTACATTATTCATCGTGTTTG pLKO_005 1628 3UTR 100% 10.800 15.120 N G3BP2 n/a
4 TRCN0000047549 CGCATCAATACCAAGGGTGTT pLKO.1 1229 CDS 100% 4.050 5.670 N G3BP2 n/a
5 TRCN0000225865 GGAGTTTGTGAGGCAATATTA pLKO_005 187 CDS 100% 15.000 10.500 N G3bp2 n/a
6 TRCN0000414061 TAAATTGAGGTGGACATTATT pLKO_005 1738 3UTR 100% 15.000 10.500 N G3BP2 n/a
7 TRCN0000434192 GACTCTGACAACCGTAGAATA pLKO_005 1100 CDS 100% 13.200 9.240 N G3BP2 n/a
8 TRCN0000412375 TCTACGACAAAGTGAACTTAA pLKO_005 1848 3UTR 100% 13.200 9.240 N G3BP2 n/a
9 TRCN0000417055 CACAATGATATGTTTCGTTAT pLKO_005 527 CDS 100% 10.800 7.560 N G3BP2 n/a
10 TRCN0000096804 AGTTAAATTGAGGTGGACATT pLKO.1 1735 3UTR 100% 4.950 3.465 N G3bp2 n/a
11 TRCN0000047550 CCACAAAGTATTATCTCTGAA pLKO.1 334 CDS 100% 4.950 3.465 N G3BP2 n/a
12 TRCN0000047552 CCGGAATATTTACACAGGTTT pLKO.1 227 CDS 100% 4.950 3.465 N G3BP2 n/a
13 TRCN0000423848 TGAAGGATCTGTTCCAAATAA pLKO_005 496 CDS 100% 15.000 9.000 N G3BP2 n/a
14 TRCN0000047551 CCAGAAAGAAAGTTTATGCAA pLKO.1 458 CDS 100% 3.000 1.800 N G3BP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008876.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02268 pDONR223 100% 93.1% 93.1% None 725_823del n/a
2 ccsbBroad304_02268 pLX_304 0% 93.1% 93.1% V5 725_823del n/a
3 TRCN0000472215 AGCCGACTAAACAGTACAAATATG pLX_317 16.4% 93.1% 93.1% V5 725_823del n/a
Download CSV