Transcript: Human XM_017009020.2

PREDICTED: Homo sapiens FCH and mu domain containing endocytic adaptor 2 (FCHO2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FCHO2 (115548)
Length:
1719
CDS:
51..1607

Additional Resources:

NCBI RefSeq record:
XM_017009020.2
NBCI Gene record:
FCHO2 (115548)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009020.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444578 AGTACAGATGAATCGGAATTT pLKO_005 1235 CDS 100% 13.200 10.560 N FCHO2 n/a
2 TRCN0000448431 AGTATCTATAGGGAATATAAC pLKO_005 1184 CDS 100% 13.200 10.560 N FCHO2 n/a
3 TRCN0000168287 GCTAGTGCAGTTGAAGGTATA pLKO.1 876 CDS 100% 10.800 7.560 N FCHO2 n/a
4 TRCN0000167536 GAAGAACAAGTAAAGTCTCAT pLKO.1 366 CDS 100% 4.950 3.465 N FCHO2 n/a
5 TRCN0000172691 GCTGCCAATACTCCAACAGTA pLKO.1 1504 CDS 100% 4.950 3.465 N FCHO2 n/a
6 TRCN0000451109 GCTTTGCCAGGAATCATTAAA pLKO_005 921 CDS 100% 15.000 9.000 N FCHO2 n/a
7 TRCN0000167218 GCTACAGTATTAAACCAGAAA pLKO.1 1015 CDS 100% 4.950 2.970 N FCHO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009020.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14358 pDONR223 100% 65.5% 59.1% None (many diffs) n/a
2 ccsbBroad304_14358 pLX_304 0% 65.5% 59.1% V5 (many diffs) n/a
3 TRCN0000472736 ATTGGGATTGACGTTGCAACCCCG pLX_317 52.5% 65.5% 59.1% V5 (many diffs) n/a
Download CSV