Transcript: Human XM_017009025.1

PREDICTED: Homo sapiens adaptor related protein complex 3 subunit sigma 1 (AP3S1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AP3S1 (1176)
Length:
6182
CDS:
133..849

Additional Resources:

NCBI RefSeq record:
XM_017009025.1
NBCI Gene record:
AP3S1 (1176)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380624 ACTTTCCATTTGGTATCTAAG pLKO_005 535 CDS 100% 10.800 7.560 N AP3S1 n/a
2 TRCN0000296529 ACTGATTTATAGACATTATGC pLKO_005 618 CDS 100% 4.950 3.465 N AP3S1 n/a
3 TRCN0000060313 CCCTACAGTGAAGATACACAA pLKO.1 496 CDS 100% 4.950 3.465 N AP3S1 n/a
4 TRCN0000060314 GCAAATCATCAGGGAGACTTT pLKO.1 519 CDS 100% 4.950 3.465 N AP3S1 n/a
5 TRCN0000060317 GTAATTTCCTAGAAGGAGGAT pLKO.1 572 CDS 100% 2.640 1.848 N AP3S1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00320 pDONR223 100% 46% 43.6% None (many diffs) n/a
2 ccsbBroad304_00320 pLX_304 0% 46% 43.6% V5 (many diffs) n/a
3 TRCN0000474919 TGCGCCCAAACAGCAAGTCATGCG pLX_317 69.4% 46% 43.6% V5 (many diffs) n/a
Download CSV