Transcript: Human XM_017009046.1

PREDICTED: Homo sapiens acyl-CoA thioesterase 12 (ACOT12), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACOT12 (134526)
Length:
3567
CDS:
21..1637

Additional Resources:

NCBI RefSeq record:
XM_017009046.1
NBCI Gene record:
ACOT12 (134526)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009046.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427738 ACATTTGGTGGCCAGATTATG pLKO_005 618 CDS 100% 13.200 9.240 N ACOT12 n/a
2 TRCN0000048724 GCCATTGTCAACAATACATTT pLKO.1 765 CDS 100% 13.200 9.240 N ACOT12 n/a
3 TRCN0000048727 CCACAGTACATCAGAAGTGAA pLKO.1 1383 CDS 100% 4.950 3.465 N ACOT12 n/a
4 TRCN0000048723 CCCTCAAAGATGGTAACACTT pLKO.1 1315 CDS 100% 4.950 3.465 N ACOT12 n/a
5 TRCN0000048726 CCTTCCTTACTTTGCTGGAAA pLKO.1 1487 CDS 100% 4.950 3.465 N ACOT12 n/a
6 TRCN0000048725 GCTGAGAAACATGCTGGAGTT pLKO.1 147 CDS 100% 4.050 2.430 N ACOT12 n/a
7 TRCN0000183700 GAGATCAGTATCAAGGTCATA pLKO.1 276 CDS 100% 4.950 6.930 N Acot12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009046.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04894 pDONR223 100% 92.2% 92.2% None (many diffs) n/a
2 ccsbBroad304_04894 pLX_304 0% 92.2% 92.2% V5 (many diffs) n/a
3 TRCN0000476440 AGACTGGGTAGCTTTGGCAAGTTG pLX_317 21.5% 92.2% 92.2% V5 (many diffs) n/a
Download CSV