Transcript: Human XM_017009048.1

PREDICTED: Homo sapiens acyl-CoA thioesterase 12 (ACOT12), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACOT12 (134526)
Length:
3363
CDS:
348..1433

Additional Resources:

NCBI RefSeq record:
XM_017009048.1
NBCI Gene record:
ACOT12 (134526)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009048.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427738 ACATTTGGTGGCCAGATTATG pLKO_005 330 5UTR 100% 13.200 9.240 N ACOT12 n/a
2 TRCN0000048724 GCCATTGTCAACAATACATTT pLKO.1 477 CDS 100% 13.200 9.240 N ACOT12 n/a
3 TRCN0000048727 CCACAGTACATCAGAAGTGAA pLKO.1 1179 CDS 100% 4.950 3.465 N ACOT12 n/a
4 TRCN0000048723 CCCTCAAAGATGGTAACACTT pLKO.1 1111 CDS 100% 4.950 3.465 N ACOT12 n/a
5 TRCN0000048726 CCTTCCTTACTTTGCTGGAAA pLKO.1 1283 CDS 100% 4.950 3.465 N ACOT12 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5 5UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009048.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04894 pDONR223 100% 61.1% 60.9% None (many diffs) n/a
2 ccsbBroad304_04894 pLX_304 0% 61.1% 60.9% V5 (many diffs) n/a
3 TRCN0000476440 AGACTGGGTAGCTTTGGCAAGTTG pLX_317 21.5% 61.1% 60.9% V5 (many diffs) n/a
Download CSV