Transcript: Human XM_017009249.2

PREDICTED: Homo sapiens Rho GTPase activating protein 26 (ARHGAP26), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGAP26 (23092)
Length:
9018
CDS:
212..2410

Additional Resources:

NCBI RefSeq record:
XM_017009249.2
NBCI Gene record:
ARHGAP26 (23092)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009249.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434204 ATGAACGGATACGGATGATTG pLKO_005 399 CDS 100% 10.800 15.120 N ARHGAP26 n/a
2 TRCN0000029754 CCTGTCTACAACTCGAACAAA pLKO.1 1208 CDS 100% 5.625 7.875 N ARHGAP26 n/a
3 TRCN0000029755 CCCTGAGAATTACGTGGAGTT pLKO.1 2430 3UTR 100% 4.050 5.670 N ARHGAP26 n/a
4 TRCN0000434831 CACTCATGATGTACCAGTTTC pLKO_005 1491 CDS 100% 10.800 7.560 N ARHGAP26 n/a
5 TRCN0000029758 GCTTCAGCATAATCAGGAAAT pLKO.1 1269 CDS 100% 10.800 7.560 N ARHGAP26 n/a
6 TRCN0000094893 CCAGTTTCAAAGAAGTTTCAT pLKO.1 1504 CDS 100% 5.625 3.938 N Arhgap26 n/a
7 TRCN0000029756 CGGCAGCATTTCTATGAAGTA pLKO.1 614 CDS 100% 4.950 3.465 N ARHGAP26 n/a
8 TRCN0000029757 GCTGAACATGACTCAGAACTT pLKO.1 2317 CDS 100% 4.950 3.465 N ARHGAP26 n/a
9 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 6230 3UTR 100% 4.950 2.475 Y NPHS1 n/a
10 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 5420 3UTR 100% 4.950 2.475 Y LOC387873 n/a
11 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 6285 3UTR 100% 4.050 2.025 Y LOC441087 n/a
12 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 5323 3UTR 100% 2.640 1.320 Y LINC01098 n/a
13 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 5291 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009249.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07836 pDONR223 100% 89.7% 79.2% None (many diffs) n/a
2 ccsbBroad304_07836 pLX_304 0% 89.7% 79.2% V5 (many diffs) n/a
3 TRCN0000469771 TCTGGCCGAGTACCGTGCCCTATT pLX_317 18.1% 89.7% 79.2% V5 (many diffs) n/a
Download CSV