Transcript: Human XM_017009306.2

PREDICTED: Homo sapiens single stranded DNA binding protein 2 (SSBP2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SSBP2 (23635)
Length:
4203
CDS:
78..1064

Additional Resources:

NCBI RefSeq record:
XM_017009306.2
NBCI Gene record:
SSBP2 (23635)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009306.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421389 ACTGTACGGAGTGGCATATTA pLKO_005 1250 3UTR 100% 15.000 21.000 N SSBP2 n/a
2 TRCN0000016216 CATCACATGAATGGCTCTTTA pLKO.1 984 CDS 100% 13.200 9.240 N SSBP2 n/a
3 TRCN0000434769 CAATGAGCGTGTGATCCATTA pLKO_005 1051 CDS 100% 10.800 7.560 N SSBP2 n/a
4 TRCN0000016213 CCCAACAAATGCCAATTCAAT pLKO.1 746 CDS 100% 5.625 3.938 N SSBP2 n/a
5 TRCN0000016217 CTCCAGAGAGACGTGAAACAT pLKO.1 301 CDS 100% 5.625 3.938 N SSBP2 n/a
6 TRCN0000016215 CCAACTCGACAACAAGGACAT pLKO.1 561 CDS 100% 4.050 2.835 N SSBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009306.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02815 pDONR223 100% 90.8% 90.8% None 957_958ins99 n/a
2 ccsbBroad304_02815 pLX_304 0% 90.8% 90.8% V5 957_958ins99 n/a
3 TRCN0000474390 CTAATACAGTTAGACAACTACTTC pLX_317 50.5% 90.8% 90.8% V5 957_958ins99 n/a
Download CSV