Transcript: Human XM_017009330.2

PREDICTED: Homo sapiens NIPBL cohesin loading factor (NIPBL), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NIPBL (25836)
Length:
9140
CDS:
1731..8528

Additional Resources:

NCBI RefSeq record:
XM_017009330.2
NBCI Gene record:
NIPBL (25836)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009330.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150167 CCACTAAATGTAGTACGCAAA pLKO.1 6208 CDS 100% 4.050 5.670 N NIPBL n/a
2 TRCN0000429040 GTTATGGAGAGACCTTATTAT pLKO_005 3995 CDS 100% 15.000 12.000 N NIPBL n/a
3 TRCN0000146423 CGGATGCTTGTCTTACAACTA pLKO.1 4036 CDS 100% 4.950 3.960 N NIPBL n/a
4 TRCN0000434717 CAGATTCAGAAGACGATATAA pLKO_005 7651 CDS 100% 15.000 10.500 N NIPBL n/a
5 TRCN0000418608 AGGATTAGTTGAAGATCTAAA pLKO_005 3080 CDS 100% 13.200 9.240 N NIPBL n/a
6 TRCN0000431388 CACTATTGAGGAAGATCTAAT pLKO_005 6314 CDS 100% 13.200 9.240 N NIPBL n/a
7 TRCN0000146613 CCTGACAATAAGGCAGAATTT pLKO.1 2916 CDS 100% 13.200 9.240 N NIPBL n/a
8 TRCN0000130175 CGCTTTGTGTTCACACCTTTA pLKO.1 7280 CDS 100% 10.800 7.560 N NIPBL n/a
9 TRCN0000148381 CTCAGGATTCAGACTCCATAA pLKO.1 1786 CDS 100% 10.800 7.560 N NIPBL n/a
10 TRCN0000146948 CCTACCTACAAGAAGAAGATA pLKO.1 6829 CDS 100% 5.625 3.938 N NIPBL n/a
11 TRCN0000129033 GCAGAGACAGAAGATGATGAA pLKO.1 8106 CDS 100% 4.950 3.465 N NIPBL n/a
12 TRCN0000128762 CCTCGTGTTAAACAAGGAGAT pLKO.1 2790 CDS 100% 4.050 2.835 N NIPBL n/a
13 TRCN0000146816 CCTGATGAAGAAGAAGAAGAA pLKO.1 8001 CDS 100% 4.950 2.970 N NIPBL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009330.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15773 pDONR223 0% 7.5% 7.3% None (many diffs) n/a
2 ccsbBroad304_15773 pLX_304 0% 7.5% 7.3% V5 (many diffs) n/a
3 TRCN0000478612 TTCTAGCTCAGTTGTAAAGACCCC pLX_317 66% 7.5% 7.3% V5 (many diffs) n/a
Download CSV