Transcript: Human XM_017009346.1

PREDICTED: Homo sapiens interleukin 17B (IL17B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL17B (27190)
Length:
1212
CDS:
373..1110

Additional Resources:

NCBI RefSeq record:
XM_017009346.1
NBCI Gene record:
IL17B (27190)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378737 TATGCCCGCATGGAGGAGTAT pLKO_005 733 CDS 100% 4.950 6.930 N IL17B n/a
2 TRCN0000008594 GTGTCACGGATGAAACCGTAT pLKO.1 715 CDS 100% 4.050 5.670 N IL17B n/a
3 TRCN0000011454 GCGCGCAGTCATGGAGACCAT pLKO.1 1062 CDS 100% 0.000 0.000 N IL17B n/a
4 TRCN0000372597 TGGACCTGGTGTCACGGATGA pLKO_005 707 CDS 100% 1.350 1.080 N IL17B n/a
5 TRCN0000008593 CCAGAGAAAGTGTGAGGTCAA pLKO.1 807 CDS 100% 4.050 2.835 N IL17B n/a
6 TRCN0000372541 GTCAACTTGCAGCTGTGGATG pLKO_005 823 CDS 100% 4.050 2.835 N IL17B n/a
7 TRCN0000372598 TGAGAGGAACATCGAGGAGAT pLKO_005 753 CDS 100% 4.050 2.835 N IL17B n/a
8 TRCN0000008596 TCTTACCATTTCCATCTTCCT pLKO.1 597 CDS 100% 2.640 1.848 N IL17B n/a
9 TRCN0000008595 GCAGCTGTGGATGTCCAACAA pLKO.1 831 CDS 100% 4.950 2.970 N IL17B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03004 pDONR223 100% 71.8% 71.4% None (many diffs) n/a
2 ccsbBroad304_03004 pLX_304 0% 71.8% 71.4% V5 (many diffs) n/a
3 TRCN0000474773 AATATGACGCAACCTATCTCTCAT pLX_317 89.1% 71.8% 71.4% V5 (many diffs) n/a
Download CSV