Transcript: Human XM_017009386.2

PREDICTED: Homo sapiens ring finger protein 180 (RNF180), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF180 (285671)
Length:
7588
CDS:
112..1743

Additional Resources:

NCBI RefSeq record:
XM_017009386.2
NBCI Gene record:
RNF180 (285671)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009386.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082756 CAGTGTATTCTGACCATACTA pLKO.1 1064 CDS 100% 5.625 7.875 N RNF180 n/a
2 TRCN0000358944 TTTAAACATGGCCCGAAATAA pLKO_005 606 CDS 100% 15.000 12.000 N RNF180 n/a
3 TRCN0000358945 GTGTATTCTGACCATACTAAT pLKO_005 1066 CDS 100% 13.200 10.560 N RNF180 n/a
4 TRCN0000235949 GCTACAGAAGCAGGGTAAATA pLKO_005 1290 CDS 100% 15.000 10.500 N Rnf180 n/a
5 TRCN0000359009 GCTACAGAAGCAGGGTAAATA pLKO_005 1290 CDS 100% 15.000 10.500 N RNF180 n/a
6 TRCN0000358943 ACTGCCTATTCCAGACTAAAT pLKO_005 868 CDS 100% 13.200 9.240 N RNF180 n/a
7 TRCN0000082754 GCTTGCCTTTACAATCTAGTA pLKO.1 914 CDS 100% 4.950 3.465 N RNF180 n/a
8 TRCN0000082755 CCAGAATGGATAAGCTGCCTA pLKO.1 313 CDS 100% 2.640 1.848 N RNF180 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009386.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05405 pDONR223 100% 76.1% 75.7% None (many diffs) n/a
2 ccsbBroad304_05405 pLX_304 0% 76.1% 75.7% V5 (many diffs) n/a
3 TRCN0000470230 TACATATTTGGGTCAACAGTCTTC pLX_317 36.4% 76.1% 75.7% V5 (many diffs) n/a
Download CSV