Transcript: Human XM_017009434.1

PREDICTED: Homo sapiens chondroitin sulfate synthase 3 (CHSY3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHSY3 (337876)
Length:
12394
CDS:
9986..11548

Additional Resources:

NCBI RefSeq record:
XM_017009434.1
NBCI Gene record:
CHSY3 (337876)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437611 AGGGACAACAGGTGTACTATC pLKO_005 11109 CDS 100% 10.800 15.120 N CHSY3 n/a
2 TRCN0000161727 CAGCAAGCATATTGAGCTGAT pLKO.1 10900 CDS 100% 4.050 5.670 N CHSY3 n/a
3 TRCN0000160090 CGATGTAGAGACAATACAATT pLKO.1 11087 CDS 100% 13.200 10.560 N CHSY3 n/a
4 TRCN0000435124 ATATGGCATCACCTGTATTTA pLKO_005 11236 CDS 100% 15.000 10.500 N CHSY3 n/a
5 TRCN0000162547 CTTGGACCCTAAGCAGTATAA pLKO.1 11422 CDS 100% 13.200 9.240 N CHSY3 n/a
6 TRCN0000158698 GACTTCAAGGAAATTCAGTAT pLKO.1 10451 CDS 100% 4.950 3.465 N CHSY3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05426 pDONR223 100% 58.9% 58.9% None 0_1ins1086 n/a
2 ccsbBroad304_05426 pLX_304 0% 58.9% 58.9% V5 0_1ins1086 n/a
3 TRCN0000475886 CTGCCCGACCATCTTTTATCCTTC pLX_317 14.1% 58.9% 58.9% V5 0_1ins1086 n/a
Download CSV