Transcript: Human XM_017009446.1

PREDICTED: Homo sapiens chromosome 5 open reading frame 34 (C5orf34), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C5orf34 (375444)
Length:
2474
CDS:
686..2260

Additional Resources:

NCBI RefSeq record:
XM_017009446.1
NBCI Gene record:
C5orf34 (375444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009446.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129656 CATCTTTAGATGGTCATGCAT pLKO.1 720 CDS 100% 3.000 4.200 N C5orf34 n/a
2 TRCN0000423429 TGGTATCCTAAACCAGATTTC pLKO_005 2080 CDS 100% 10.800 8.640 N C5orf34 n/a
3 TRCN0000146657 CCTGGGATAAATGATAGCAAT pLKO.1 1661 CDS 100% 4.950 3.960 N C5orf34 n/a
4 TRCN0000147771 GATGGACAAGAGCAGTTAATT pLKO.1 1874 CDS 100% 15.000 10.500 N C5orf34 n/a
5 TRCN0000434524 AGAAGATGAGTTGTGTAAATG pLKO_005 972 CDS 100% 13.200 9.240 N C5orf34 n/a
6 TRCN0000428142 GGCATTACTCTAACCCTAAAT pLKO_005 1775 CDS 100% 13.200 9.240 N C5orf34 n/a
7 TRCN0000422060 TTTGTCTTTAGCACTTCATTT pLKO_005 1105 CDS 100% 13.200 9.240 N C5orf34 n/a
8 TRCN0000425382 ATTGAACACCCTGAACCATAT pLKO_005 1898 CDS 100% 10.800 7.560 N C5orf34 n/a
9 TRCN0000447473 CAGAGAGATGCCCACTCATTC pLKO_005 1975 CDS 100% 10.800 7.560 N C5orf34 n/a
10 TRCN0000413503 AGTTTAACTTGCTACTAGAAA pLKO_005 2055 CDS 100% 5.625 3.938 N C5orf34 n/a
11 TRCN0000149513 GCCTACTCTGATGACAAAGTA pLKO.1 1736 CDS 100% 5.625 3.938 N C5orf34 n/a
12 TRCN0000146578 CACGATATTGACTGTCTTCTA pLKO.1 2222 CDS 100% 4.950 3.465 N C5orf34 n/a
13 TRCN0000150206 GCACATATAACTCAGAGTAGA pLKO.1 1160 CDS 100% 4.950 3.465 N C5orf34 n/a
14 TRCN0000147494 GTTGTTTCAAGTGACTGGTAT pLKO.1 2301 3UTR 100% 4.950 3.465 N C5orf34 n/a
15 TRCN0000148489 CCAGTCTTGATACAGATGGTA pLKO.1 663 5UTR 100% 3.000 2.100 N C5orf34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009446.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10071 pDONR223 100% 82.1% 82.1% None 0_1ins342 n/a
2 ccsbBroad304_10071 pLX_304 0% 82.1% 82.1% V5 0_1ins342 n/a
3 TRCN0000473101 CGGACAAGGGTAATGTCTGTTTCG pLX_317 24.4% 82.1% 82.1% V5 0_1ins342 n/a
Download CSV