Transcript: Human XM_017009484.1

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase 1 (MAP3K1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K1 (4214)
Length:
8567
CDS:
3624..7751

Additional Resources:

NCBI RefSeq record:
XM_017009484.1
NBCI Gene record:
MAP3K1 (4214)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009484.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196442 GACCCACAGTTGACCTTTATT pLKO.1 8273 3UTR 100% 15.000 21.000 N MAP3K1 n/a
2 TRCN0000197225 GCCACAGTTTAGCGGAAAGAA pLKO.1 5212 CDS 100% 5.625 7.875 N MAP3K1 n/a
3 TRCN0000350517 GCCACAGTTTAGCGGAAAGAA pLKO_005 5212 CDS 100% 5.625 7.875 N MAP3K1 n/a
4 TRCN0000006160 GCCTTTCGTATCTCCATGAAA pLKO.1 7279 CDS 100% 5.625 7.875 N MAP3K1 n/a
5 TRCN0000315395 ATCTCATCATTCCCAATTAAT pLKO_005 6128 CDS 100% 15.000 10.500 N MAP3K1 n/a
6 TRCN0000196286 GCTCATTTGCTGAGTAAATAT pLKO.1 7206 CDS 100% 15.000 10.500 N MAP3K1 n/a
7 TRCN0000350518 TGAAGTTTGCATGACTAAATT pLKO_005 8008 3UTR 100% 15.000 10.500 N MAP3K1 n/a
8 TRCN0000196318 GATGTGGCTCTTCGTTGTTTA pLKO.1 7659 CDS 100% 13.200 9.240 N MAP3K1 n/a
9 TRCN0000006159 GCCTGTTGAAATCAGGTATAA pLKO.1 5567 CDS 100% 13.200 9.240 N MAP3K1 n/a
10 TRCN0000196823 GCAATTACAATCTCTTCATTG pLKO.1 7162 CDS 100% 10.800 7.560 N MAP3K1 n/a
11 TRCN0000315434 GGCGTAGCTCAAGGATCAAAG pLKO_005 4396 CDS 100% 10.800 7.560 N MAP3K1 n/a
12 TRCN0000196615 GTAGCAGCAATAGTAGTAATG pLKO.1 6502 CDS 100% 10.800 7.560 N MAP3K1 n/a
13 TRCN0000006161 CCTCTCCTTTATCTCATCATT pLKO.1 6118 CDS 100% 5.625 3.938 N MAP3K1 n/a
14 TRCN0000025182 CCAGTAACATACACAGGCCAA pLKO.1 6373 CDS 100% 2.160 1.512 N Map3k1 n/a
15 TRCN0000193184 CAACAACAACAACAACAGAAA pLKO.1 6043 CDS 100% 4.950 2.475 Y Dclre1c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009484.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.