Transcript: Human XM_017009776.1

PREDICTED: Homo sapiens solute carrier family 22 member 4 (SLC22A4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC22A4 (6583)
Length:
2233
CDS:
742..1869

Additional Resources:

NCBI RefSeq record:
XM_017009776.1
NBCI Gene record:
SLC22A4 (6583)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009776.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043284 CCTTGATTGAAATTCCAGCTT pLKO.1 1346 CDS 100% 2.640 2.112 N SLC22A4 n/a
2 TRCN0000043283 CCTGTGGATTATTACTTCTTA pLKO.1 1468 CDS 100% 5.625 3.938 N SLC22A4 n/a
3 TRCN0000043286 CCTCGGTGCTTACAACAGAAT pLKO.1 1653 CDS 100% 4.950 3.465 N SLC22A4 n/a
4 TRCN0000043285 GCCTTCATACTAGGAACAGAA pLKO.1 853 CDS 100% 4.950 3.465 N SLC22A4 n/a
5 TRCN0000070236 CCAAGGTTCTAATAACTGCAT pLKO.1 1844 CDS 100% 2.640 1.848 N Slc22a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009776.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489839 TTCACACCGTTTACACATAAATGC pLX_317 22.9% 67.9% 68% V5 (not translated due to prior stop codon) 0_1ins528;705G>C n/a
Download CSV