Transcript: Human XM_017009961.2

PREDICTED: Homo sapiens family with sequence similarity 172 member A (FAM172A), transcript variant X27, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM172A (83989)
Length:
13932
CDS:
118..903

Additional Resources:

NCBI RefSeq record:
XM_017009961.2
NBCI Gene record:
FAM172A (83989)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009961.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127701 GCGACGTGATTTCTATGAGAA pLKO.1 642 CDS 100% 4.950 6.930 N FAM172A n/a
2 TRCN0000146308 CATGCAATCTATGTTTGGGAT pLKO.1 733 CDS 100% 2.640 3.696 N FAM172A n/a
3 TRCN0000150118 CTACCGCACTGAAAGATTTAT pLKO.1 209 CDS 100% 15.000 10.500 N FAM172A n/a
4 TRCN0000148299 CCTGAAGAACATGCAATCTAT pLKO.1 724 CDS 100% 5.625 3.375 N FAM172A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009961.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04314 pDONR223 100% 59.8% 58.7% None (many diffs) n/a
2 ccsbBroad304_04314 pLX_304 0% 59.8% 58.7% V5 (many diffs) n/a
3 TRCN0000479117 CGCCGGTCCCAGCCCATAGAACCT pLX_317 34.4% 59.8% 58.7% V5 (many diffs) n/a
Download CSV