Transcript: Human XM_017009987.1

PREDICTED: Homo sapiens multiple EGF like domains 10 (MEGF10), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MEGF10 (84466)
Length:
7934
CDS:
443..4030

Additional Resources:

NCBI RefSeq record:
XM_017009987.1
NBCI Gene record:
MEGF10 (84466)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009987.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422568 GGGTCGTCAATGCAGATTATA pLKO_005 3306 CDS 100% 15.000 21.000 N MEGF10 n/a
2 TRCN0000436749 GCTATGGCTGTCGCCAGATAT pLKO_005 2991 CDS 100% 13.200 18.480 N MEGF10 n/a
3 TRCN0000164193 CGAGCTGCACTGACATTCTAA pLKO.1 780 CDS 100% 5.625 7.875 N MEGF10 n/a
4 TRCN0000161651 GAAGACTATGTATAGGCGCAA pLKO.1 859 CDS 100% 2.160 3.024 N MEGF10 n/a
5 TRCN0000159078 GCTTTGGCTGTAACTTAACAT pLKO.1 2082 CDS 100% 5.625 4.500 N MEGF10 n/a
6 TRCN0000160104 CTACTGGCATTGTTCATTATT pLKO.1 3221 CDS 100% 15.000 10.500 N MEGF10 n/a
7 TRCN0000428794 GAGCTGACTGCGACCACATTT pLKO_005 2898 CDS 100% 13.200 9.240 N MEGF10 n/a
8 TRCN0000161291 GCAATGGTGGAAACGCTAATA pLKO.1 3351 CDS 100% 13.200 9.240 N MEGF10 n/a
9 TRCN0000421018 TCATGTGAATGTTAGTCAATT pLKO_005 4112 3UTR 100% 13.200 9.240 N MEGF10 n/a
10 TRCN0000158939 GCAGAGATCAATAACTCAACT pLKO.1 3791 CDS 100% 4.950 3.465 N MEGF10 n/a
11 TRCN0000119451 CAAAGAACAGTCACATCCCTT pLKO.1 3912 CDS 100% 2.640 1.848 N Megf10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009987.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09193 pDONR223 100% 95.3% 95.3% None (many diffs) n/a
2 ccsbBroad304_09193 pLX_304 0% 95.3% 95.3% V5 (many diffs) n/a
3 TRCN0000479271 TGAACTTAGAGCTCTTCGATGGTC pLX_317 10.5% 95.3% 95.3% V5 (many diffs) n/a
Download CSV