Transcript: Human XM_017010021.2

PREDICTED: Homo sapiens T cell immunoglobulin and mucin domain containing 4 (TIMD4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TIMD4 (91937)
Length:
1165
CDS:
29..1000

Additional Resources:

NCBI RefSeq record:
XM_017010021.2
NBCI Gene record:
TIMD4 (91937)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010021.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154537 GCATCTGATACAGCAGTTCCT pLKO.1 707 CDS 100% 2.640 3.696 N TIMD4 n/a
2 TRCN0000151706 CCCATGTCAATGAAGAATGAA pLKO.1 770 CDS 100% 5.625 3.938 N TIMD4 n/a
3 TRCN0000153327 GATGTCTCCTTGACCATCTTA pLKO.1 308 CDS 100% 5.625 3.938 N TIMD4 n/a
4 TRCN0000155792 CCACCCGACAAATGACAACAA pLKO.1 495 CDS 100% 4.950 3.465 N TIMD4 n/a
5 TRCN0000152637 GAAACACACAAGGCTAGACTA pLKO.1 904 CDS 100% 4.950 3.465 N TIMD4 n/a
6 TRCN0000151257 GAAACCTATTGTTCGCAGAAA pLKO.1 887 CDS 100% 4.950 3.465 N TIMD4 n/a
7 TRCN0000155535 GATGACAACCATTGCCGTCTT pLKO.1 580 CDS 100% 4.050 2.835 N TIMD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010021.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09327 pDONR223 100% 85.4% 85.4% None 677_678ins165 n/a
2 ccsbBroad304_09327 pLX_304 0% 85.4% 85.4% V5 677_678ins165 n/a
3 TRCN0000470639 TTCGAACATTTGCTGCTGACCCGC pLX_317 42.8% 85.4% 85.4% V5 677_678ins165 n/a
Download CSV