Transcript: Human XM_017010121.1

PREDICTED: Homo sapiens zinc finger DHHC-type containing 11B (ZDHHC11B), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZDHHC11B (653082)
Length:
3064
CDS:
1237..2142

Additional Resources:

NCBI RefSeq record:
XM_017010121.1
NBCI Gene record:
ZDHHC11B (653082)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130923 CCACCACTGCAAATGGATCAA pLKO.1 1857 CDS 100% 4.950 2.475 Y ZDHHC11 n/a
2 TRCN0000127619 CCACTGCAAATGGATCAACAA pLKO.1 1860 CDS 100% 4.950 2.475 Y ZDHHC11 n/a
3 TRCN0000148432 CTCCAATGTCAGACTCATGAA pLKO.1 1527 CDS 100% 4.950 2.475 Y ZDHHC11 n/a
4 TRCN0000149057 GCCGGAATTATTGGTTCTTCT pLKO.1 1892 CDS 100% 4.950 2.475 Y ZDHHC11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04137 pDONR223 100% 48.8% 42.4% None (many diffs) n/a
2 ccsbBroad304_04137 pLX_304 0% 48.8% 42.4% V5 (many diffs) n/a
3 TRCN0000465206 GACGAATCAGGCCCTCGAACGTCA pLX_317 13.4% 48.8% 42.4% V5 (many diffs) n/a
Download CSV