Transcript: Human XM_017010182.1

PREDICTED: Homo sapiens testis expressed basic protein 1 (TSBP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSBP1 (10665)
Length:
3877
CDS:
10..1419

Additional Resources:

NCBI RefSeq record:
XM_017010182.1
NBCI Gene record:
TSBP1 (10665)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142956 CCAGATACAAACCATATCCCA pLKO.1 1473 3UTR 100% 0.750 1.050 N TSBP1 n/a
2 TRCN0000141394 CCAAGTAACGAAGAGTGGGTT pLKO.1 780 CDS 100% 2.640 3.432 N TSBP1 n/a
3 TRCN0000122197 GCCCATAAGACAAGTGATTAT pLKO.1 1437 3UTR 100% 13.200 9.240 N TSBP1 n/a
4 TRCN0000122021 GCACTAAAGAATGACATCATA pLKO.1 481 CDS 100% 5.625 3.938 N TSBP1 n/a
5 TRCN0000141245 CCAGCCATTGCCTAAACAGAT pLKO.1 1491 3UTR 100% 4.950 3.465 N TSBP1 n/a
6 TRCN0000144791 GAATACCTCAAGTTCACACTA pLKO.1 308 CDS 100% 4.950 3.465 N TSBP1 n/a
7 TRCN0000142098 GAGGGAGTCAGTTGTACTGAA pLKO.1 927 CDS 100% 4.950 3.465 N TSBP1 n/a
8 TRCN0000141823 GCCACAAACCTCAGTTTCCAA pLKO.1 1587 3UTR 100% 3.000 2.100 N TSBP1 n/a
9 TRCN0000164757 CCAGAGAGAGAGAGAGTGATA pLKO.1 3773 3UTR 100% 4.950 2.475 Y NAT16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07665 pDONR223 100% 70.7% 70.3% None (many diffs) n/a
2 ccsbBroad304_07665 pLX_304 0% 70.7% 70.3% V5 (many diffs) n/a
3 TRCN0000475721 CCTGATGAACCGTGAGTCAGTAAC pLX_317 19.6% 70.7% 70.3% V5 (many diffs) n/a
Download CSV