Transcript: Human XM_017010312.2

PREDICTED: Homo sapiens PARN like, ribonuclease domain containing 1 (PNLDC1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PNLDC1 (154197)
Length:
2659
CDS:
781..2472

Additional Resources:

NCBI RefSeq record:
XM_017010312.2
NBCI Gene record:
PNLDC1 (154197)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010312.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049769 GCCATCGGAGTGGTATCTAAA pLKO.1 1023 CDS 100% 13.200 18.480 N PNLDC1 n/a
2 TRCN0000438130 GTTCGCAGCTCTCCGGATAAA pLKO_005 1330 CDS 100% 13.200 18.480 N PNLDC1 n/a
3 TRCN0000049771 CGCTATTGAAGGAGAGGCAAA pLKO.1 1101 CDS 100% 4.050 3.240 N PNLDC1 n/a
4 TRCN0000049768 CCAGAAAGCTACGATCAATTT pLKO.1 1726 CDS 100% 13.200 9.240 N PNLDC1 n/a
5 TRCN0000420492 GATACCAAGAGTGTAACAAAG pLKO_005 1783 CDS 100% 10.800 7.560 N PNLDC1 n/a
6 TRCN0000049770 CAGTTCTTACTCCTGACCAAT pLKO.1 2278 CDS 100% 4.950 3.465 N PNLDC1 n/a
7 TRCN0000049772 GCAGAATATCCACAGCCTATT pLKO.1 1749 CDS 100% 10.800 6.480 N PNLDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010312.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09708 pDONR223 100% 91% 87.6% None (many diffs) n/a
2 ccsbBroad304_09708 pLX_304 0% 91% 87.6% V5 (many diffs) n/a
3 TRCN0000467701 ATATCAACAATATATTTGATCCTC pLX_317 23.3% 91% 87.6% V5 (many diffs) n/a
Download CSV