Transcript: Human XM_017010389.1

PREDICTED: Homo sapiens adenylate kinase 9 (AK9), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AK9 (221264)
Length:
5090
CDS:
575..4576

Additional Resources:

NCBI RefSeq record:
XM_017010389.1
NBCI Gene record:
AK9 (221264)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127785 GAAGAGGTAACTGCAGATCAT pLKO.1 539 5UTR 100% 4.950 6.930 N AK9 n/a
2 TRCN0000140490 GCTCTAGTACCTGGTAGCATT pLKO.1 4064 CDS 100% 4.950 6.930 N AK9 n/a
3 TRCN0000140806 GAATTGTACGTGCCTCCCTTA pLKO.1 3905 CDS 100% 4.050 5.670 N AK9 n/a
4 TRCN0000121600 CTCAGAAATATAGACCCAATT pLKO.1 4547 CDS 100% 10.800 7.560 N AK9 n/a
5 TRCN0000140149 GCTACTGTCCAGTGACCTATA pLKO.1 4020 CDS 100% 10.800 7.560 N AK9 n/a
6 TRCN0000139016 CCAGACTTCAGGTGAACTCAA pLKO.1 4706 3UTR 100% 4.950 3.465 N AK9 n/a
7 TRCN0000139806 CTGCAACTGACTCCTTGGAAT pLKO.1 3810 CDS 100% 4.950 3.465 N AK9 n/a
8 TRCN0000130007 GAAGACTCTTATCCTGATGTT pLKO.1 1280 CDS 100% 4.950 3.465 N AK9 n/a
9 TRCN0000140743 GCAGCCTGAATCTCAAGAGTT pLKO.1 4592 3UTR 100% 4.950 3.465 N AK9 n/a
10 TRCN0000127757 GAAGAGGAGATTGAAGGTGAT pLKO.1 1043 CDS 100% 4.050 2.835 N AK9 n/a
11 TRCN0000143947 CCCAGGAATTATTTGATTGCT pLKO.1 3789 CDS 100% 3.000 2.100 N AK9 n/a
12 TRCN0000128113 CAGTGGAAACAGAAATCCCAA pLKO.1 1194 CDS 100% 2.640 1.848 N AK9 n/a
13 TRCN0000156756 GAGGAAGAGGAAGAGGAAGAT pLKO.1 1556 CDS 100% 4.950 2.475 Y NPM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13422 pDONR223 100% 23.2% 23.2% None 1_3069del n/a
2 ccsbBroad304_13422 pLX_304 0% 23.2% 23.2% V5 1_3069del n/a
3 TRCN0000478093 GATAACACCGTCATCCACTACAAT pLX_317 13.1% 23.2% 23.2% V5 1_3069del n/a
Download CSV